No Title

 

Embed or link this publication

Popular Pages


p. 1

molecular components of cells part i c hapter 1 chemistry is the logic of biological phenomena c hapter 2 water ph and ionic equilibria c hapter 3 thermodynamics of biological systems c hapter 4 amino acids c hapter 5 proteins their biological functions and primary structure appendix to chapter 5 protein techniques c hapter 6 proteins secondary tertiary and quaternary structure c hapter 7 carbohydrates c hapter 8 lipids all life depends on water all organisms are aqueous chemical systems waves in oahu hawaii brad lewis/liaison international c hapter 9 membranes and cell surfaces c hapter 10 membrane transport c hapter 11 nucleotides c hapter 12 nucleic acids c hapter 13 recombinant dna

[close]

p. 2

everything that living things do can be understood in terms of the jigglings and wigglings of atoms richard p feynman lectures on physics addison-wesley publishing company 1963 c hapter 1 chemistry is the logic of biological phenomena outline 1.1 1.2 1.3 distinctive properties of living systems biomolecules the molecules of life a biomolecular hierarchy simple molecules are the units for building complex structures properties of biomolecules reflect their fitness to the living condition organization and structure of cells viruses are supramolecular assemblies acting as cell parasites 1.4 1.5 1.6 swamp animals and birds on the river gambia c 1912 by harry hamilton johnston 1858­1927 royal geographical society london/the bridgeman art library 2 olecules are lifeless yet in appropriate complexity and number molecules compose living things these living systems are distinct from the inanimate world because they have certain extraordinary properties they can grow move perform the incredible chemistry of metabolism respond to stimuli from the environment and most significantly replicate themselves with exceptional fidelity the complex structure and behavior of living organisms veil the basic truth that their molecular constitution can be described and understood the chemistry of the living cell resembles the chemistry of organic reactions m

[close]

p. 3

1.1 distinctive properties of living systems 3 indeed cellular constituents or biomolecules must conform to the chemical and physical principles that govern all matter despite the spectacular diversity of life the intricacy of biological structures and the complexity of vital mechanisms life functions are ultimately interpretable in chemical terms chemistry is the logic of biological phenomena logic a system of reasoning using principles of valid inference 1.1 distinctive properties of living systems the most obvious quality of living organisms is that they are complicated and highly organized figure 1.1 for example organisms large enough to be seen with the naked eye are composed of many cells typically of many types in turn these cells possess subcellular structures or organelles which are complex assemblies of very large polymeric molecules or macromolecules these macromolecules themselves show an exquisite degree of organization in their intricate three-dimensional architecture even though they are composed of simple sets of chemical building blocks such as sugars and amino acids indeed the complex three-dimensional structure of a macromolecule known as its conformation is a consequence of interactions between the monomeric units according to their individual chemical properties biological structures serve functional purposes that is biological structures have a role in terms of the organism s existence from parts of organisms such as limbs and organs down to the chemical agents of metabolism such as enzymes and metabolic intermediates a biological purpose can be given for each component indeed it is this functional characteristic of biological structures that separates the science of biology from studies of the inanimate world such as chemistry physics and geology in biology it is always meaningful to seek the purpose of observed structures organizations or patterns that is to ask what functional role they serve within the organism living systems are actively engaged in energy transformations the maintenance of the highly organized structure and activity of living systems depends upon their ability to extract energy from the environment the ultimate source of energy is the sun solar energy flows from photosynthetic organisms those organisms able to capture light energy by the process of photosynthesis through a b figure 1.1 a mandrill mandrillus sphinx a baboon native to west africa b tropical orchid bulbophyllum blumei new guinea a tony angermayer/photo researchers inc b thomas c boydon/marie selby botanical gardens

[close]

p. 4

4 chapter 1 chemistry is the logic of biological phenomena figure 1.2 the food pyramid photosynthetic organisms at the base capture light energy herbivores and carnivores derive their energy ultimately from these primary producers food chains to herbivores and ultimately to carnivorous predators at the apex of the food pyramid figure 1.2 the biosphere is thus a system through which energy flows organisms capture some of this energy be it from photosynthesis or the metabolism of food by forming special energized biomolecules of which atp and nadph are the two most prominent examples figure 1.3 commonly used abbreviations such as atp and nadph are defined on the inside back cover of this book atp and nadph are energized biomolecules because they represent chemically useful forms of stored energy we explore the chemical basis of this stored energy in subsequent chapters for now suffice it to say that when these molecules react with other molecules in the cell the energy released can be used to drive unfavorable processes that is atp nadph and related compounds are the power sources that drive the energyrequiring activities of the cell including biosynthesis movement osmotic work against concentration gradients and in special instances light emission bioluminescence only upon death does an organism reach equilibrium with its inanimate environment the living state is characterized by the flow of energy through the organism at the expense of this energy flow the organism can maintain its nh2 o­ ­o pooo­ pooo­ pohh oh oh atp och2 ohhnnnnhhcoo­ pohhh oh nadph o o o­ p o h och2 ohhopo­ n n nh2 n n nh2 n h2co o h h oh oh o­ figure 1.3 atp and nadph two biochemically important energy-rich compounds.

[close]

p. 5

1.1 distinctive properties of living systems 5 intricate order and activity far removed from equilibrium with its surroundings yet exist in a state of apparent constancy over time this state of apparent constancy or so-called steady-state is actually a very dynamic condition energy and material are consumed by the organism and used to maintain its stability and order in contrast inanimate matter as exemplified by the universe in totality is moving to a condition of increasing disorder or in thermodynamic terms maximum entropy living systems have a remarkable capacity for self-replication generation after generation organisms reproduce virtually identical copies of themselves this self-replication can proceed by a variety of mechanisms ranging from simple division in bacteria to sexual reproduction in plants and animals but in every case it is characterized by an astounding degree of fidelity figure 1.4 indeed if the accuracy of self-replication were significantly greater the evolution of organisms would be hampered this is so because evolution depends upon natural selection operating on individual organisms that vary slightly in their fitness for the environment the fidelity of self-replication resides ultimately in the chemical nature of the genetic material this substance consists of polymeric chains of deoxyribonucleic acid or dna which are structurally complementary to one another figure 1.5 these molecules can generate new copies of themselves in a rigorously executed polymerization process that ensures a faithful reproduction of the original dna strands in contrast the a b figure 1.4 organisms resemble their parents a reg garrett with sons robert jeffrey randal and grandson jackson b orangutan with infant c the grishams andrew rosemary charles emily and david a william w garrett ii b randal harrison garrett c charles y sipe c

[close]

p. 6

6 chapter 1 chemistry is the logic of biological phenomena a 5 t a 3 gctatgccgatgccgcgatta 5 3 figure 1.5 the dna double helix two complementary polynucleotide chains running in opposite directions can pair through hydrogen bonding between their nitrogenous bases their complementary nucleotide sequences give rise to structural complementarity complementary completing making whole or perfect by combining or filling a deficiency molecules of the inanimate world lack this capacity to replicate a crude mechanism of replication or specification of unique chemical structure according to some blueprint must have existed at life s origin this primordial system no doubt shared the property of structural complementarity see later section with the highly evolved patterns of replication prevailing today 1.2 biomolecules the molecules of life the elemental composition of living matter differs markedly from the relative abundance of elements in the earth s crust table 1.1 hydrogen oxygen carbon and nitrogen constitute more than 99 of the atoms in the human body with most of the h and o occurring as h2o oxygen silicon aluminum and iron are the most abundant atoms in the earth s crust with hydrogen carbon and nitrogen being relatively rare less than 0.2 each nitrogen as dinitrogen n2 is the predominant gas in the atmosphere and carbon dioxide co2 is present at a level of 0.05 a small but critical amount oxygen is also abundant in the atmosphere and in the oceans what property unites h o c and table 1.1 composition of the earth s crust seawater and the human body earth s crust element seawater compound mm human body element o si al fe ca na k mg ti h c 47 28 7.9 4.5 3.5 2.5 2.5 2.2 0.46 0.22 0.19 cl na mg2 so42 ca2 k hco3 no3 hpo42 548 470 54 28 10 10 2.3 0.01 0.001 hocn ca p cl k s na mg 63 25.5 9.5 1.4 0.31 0.22 0.08 0.06 0.05 0.03 0.01 figures for the earth s crust and the human body are presented as percentages of the total number of atoms seawater data are millimoles per liter figures for the earth s crust do not include water whereas figures for the human body do trace elements found in the human body serving essential biological functions include mn fe co cu zn mo i ni and se.

[close]

p. 7

1.2 biomolecules the molecules of life 7 n and renders these atoms so suitable to the chemistry of life it is their ability to form covalent bonds by electron-pair sharing furthermore h c n and o are among the lightest elements of the periodic table capable of forming such bonds figure 1.6 because the strength of covalent bonds is inversely proportional to the atomic weights of the atoms involved h c n and o form the strongest covalent bonds two other covalent bond-forming elements phosphorus as phosphate oopo32 derivatives and sulfur also play important roles in biomolecules biomolecules are carbon compounds all biomolecules contain carbon the prevalence of c is due to its unparalleled versatility in forming stable covalent bonds by electron-pair sharing carbon can form as many as four such bonds by sharing each of the four electrons in its outer shell with electrons contributed by other atoms atoms commonly found in covalent linkage to c are c itself h o and n hydrogen can form one such bond by contributing its single electron to formation of an electron pair oxygen with two unpaired electrons in its outer shell can participate in two covalent bonds and nitrogen which has three unshared electrons can form three such covalent bonds furthermore c n and o can share two electron pairs to form double bonds with one another within biomolecules a property that enhances their chemical versatility carbon and nitrogen can even share three electron pairs to form triple bonds atoms h c covalent bond e­ pairing hhchhchh bond energy kj/mol 436 414 hhcccccc 343 cncncn 292 cococo 351 cccccc 615 figure 1.6 covalent bond formation by e pair sharing cncncn 615 coonnoooonhhcocoonnoooonhh 686 142 402 946 393 460 oooonnnhoh

[close]

p. 8

8 chapter 1 chemistry is the logic of biological phenomena figure 1.7 examples of the versatility of coc bonds in building complex structures linear aliphatic cyclic branched and planar linear aliphatic stearic acid hooc ch216 ch3 ohcc ho hchh hh cchh hh cchh hh cchh hh cchh hh cchh hh cchh hh c c h hh c h h cyclic cholesterol h h3c h3c ch3 c ch2 ch2 ch2 h c ch3 ch3 ho branched -carotene h3c h3c ch3 ch3 ch3 ch3 ch3 ch3 h3c ch3 planar chlorophyll a h3c ch2ch3 h2c hc n h3c n mg n 2 ch3 n o h3c ch2 ch2 coocohcchh och3 ch3 ch3 ch3 ch3 hhhhhhhhhhcccccccccccccchhhhhhhhhhhhhh

[close]

p. 9

1.3 a biomolecular hierarchy simple molecules are the units for building complex structures 9 two properties of carbon covalent bonds merit particular attention one is the ability of carbon to form covalent bonds with itself the other is the tetrahedral nature of the four covalent bonds when carbon atoms form only single bonds together these properties hold the potential for an incredible variety of linear branched and cyclic compounds of c this diversity is multiplied further by the possibilities for including n o and h atoms in these compounds figure 1.7 we can therefore envision the ability of c to generate complex structures in three dimensions these structures by virtue of appropriately included n o and h atoms can display unique chemistries suitable to the living state thus we may ask is there any pattern or underlying organization that brings order to this astounding potentiality 1.3 a biomolecular hierarchy simple molecules are the units for building complex structures examination of the chemical composition of cells reveals a dazzling variety of organic compounds covering a wide range of molecular dimensions table 1.2 as this complexity is sorted out and biomolecules are classified according to the similarities in size and chemical properties an organizational pat table 1.2 biomolecular dimensions the dimensions of mass and length for biomolecules are given typically in daltons and nanometers respectively one dalton d is the mass of one hydrogen atom 1.67 10 24 g one nanometer nm is 10 9 m or 10 Å angstroms mass biomolecule length long dimension nm daltons picograms water alanine glucose phospholipid ribonuclease a small protein immunoglobulin g igg myosin a large muscle protein ribosome bacteria bacteriophage x174 a very small bacterial virus pyruvate dehydrogenase complex a multienzyme complex tobacco mosaic virus a plant virus mitochondrion liver escherichia coli cell chloroplast spinach leaf liver cell 20,0000.3 20,0000.5 20,0000.7 20,0003.5 20,004 20,014 20,160 20,018 20,025 20,060 20,300 21,500 22,000 28,000 20,000 40,000,018 40,000,089 40,000,180 40,000,750 40,012,600 40,150,000 40,470,000 42,520,000 44,700,000 47,000,000 40,000,000 8,006.68 1.5 2 60 8,000 10 5 molecular mass is expressed in units of daltons d or kilodaltons kd in this book alternatively the dimensionless term molecular weight symbolized by mr and defined as the ratio of the mass of a molecule to 1 dalton of mass is used prefixes used for powers of 10 are 106 mega m 10 3 milli m 103 kilo k 10 6 micro 1 10 deci d 10 9 nano n 10 2 centi c 10 12 pico p 10 15 femto f

[close]

p. 10

10 chapter 1 chemistry is the logic of biological phenomena tern emerges the molecular constituents of living matter do not reflect randomly the infinite possibilities for combining c h o and n atoms instead only a limited set of the many possibilities is found and these collections share certain properties essential to the establishment and maintenance of the living state the most prominent aspect of biomolecular organization is that macromolecular structures are constructed from simple molecules according to a hierarchy of increasing structural complexity what properties do these biomolecules possess that make them so appropriate for the condition of life metabolites and macromolecules the major precursors for the formation of biomolecules are water carbon dioxide and three inorganic nitrogen compounds ammonium nh4 nitrate no3 and dinitrogen n2 metabolic processes assimilate and transform these inorganic precursors through ever more complex levels of biomolecular order figure 1.8 in the first step precursors are converted to metabolites simple organic compounds that are intermediates in cellular energy transformation and in the biosynthesis of various sets of building blocks amino acids sugars nucleotides fatty acids and glycerol by covalent linkage of these building blocks the macromolecules are constructed proteins polysaccharides polynucleotides dna and rna and lipids strictly speaking lipids contain relatively few building blocks and are therefore not really polymeric like other macromolecules however lipids are important contributors to higher levels of complexity interactions among macromolecules lead to the next level of structural organization supramolecular complexes here various members of one or more of the classes of macromolecules come together to form specific assemblies serving important subcellular functions examples of these supramolecular assemblies are multifunctional enzyme complexes ribosomes chromosomes and cytoskeletal elements for example a eukaryotic ribosome contains four different rna molecules and at least 70 unique proteins these supramolecular assemblies are an interesting contrast to their components because their structural integrity is maintained by noncovalent forces not by covalent bonds these noncovalent forces include hydrogen bonds ionic attractions van der waals forces and hydrophobic interactions between macromolecules such forces maintain these supramolecular assemblies in a highly ordered functional state although noncovalent forces are weak less than 40 kj/mol they are numerous in these assemblies and thus can collectively maintain the essential architecture of the supramolecular complex under conditions of temperature ph and ionic strength that are consistent with cell life organelles the next higher rung in the hierarchical ladder is occupied by the organelles entities of considerable dimensions compared to the cell itself organelles are found only in eukaryotic cells that is the cells of higher organisms eukaryotic cells are described in section 1.5 several kinds such as mitochondria and chloroplasts evolved from bacteria that gained entry to the cytoplasm of early eukaryotic cells organelles share two attributes they are cellular inclusions usually membrane bounded and are dedicated to important cellular tasks organelles include the nucleus mitochondria chloroplasts endoplasmic reticulum golgi apparatus and vacuoles as well as other relatively small cellular inclusions such as peroxisomes lysosomes and chromoplasts the nucleus is the repository of genetic information as contained within the linear sequences of nucleotides in the dna of chromosomes mitochondria are the

[close]

p. 11

figure 1.8 molecular organization in the cell is a hierarchy power plants of cells by virtue of their ability to carry out the energy-releasing aerobic metabolism of carbohydrates and fatty acids capturing the energy in metabolically useful forms such as atp chloroplasts endow cells with the ability to carry out photosynthesis they are the biological agents for harvesting light energy and transforming it into metabolically useful chemical forms 11

[close]

p. 12

12 chapter 1 chemistry is the logic of biological phenomena membranes membranes define the boundaries of cells and organelles as such they are not easily classified as supramolecular assemblies or organelles although they share the properties of both membranes resemble supramolecular complexes in their construction because they are complexes of proteins and lipids maintained by noncovalent forces hydrophobic interactions are particularly important in maintaining membrane structure hydrophobic interactions arise because water molecules prefer to interact with each other rather than with nonpolar substances the presence of nonpolar molecules lessens the range of opportunities for water­water interaction by forcing the water molecules into ordered arrays around the nonpolar groups such ordering can be minimized if the individual nonpolar molecules redistribute from a dispersed state in the water into an aggregated organic phase surrounded by water the spontaneous assembly of membranes in the aqueous environment where life arose and exists is the natural result of the hydrophobic water-fearing character of their lipids and proteins hydrophobic interactions are the creative means of membrane formation and the driving force that presumably established the boundary of the first cell the membranes of organelles such as nuclei mitochondria and chloroplasts differ from one another with each having a characteristic protein and lipid composition suited to the organelle s function furthermore the creation of discrete volumes or compartments within cells is not only an inevitable consequence of the presence of membranes but usually an essential condition for proper organellar function the unit of life is the cell the cell is characterized as the unit of life the smallest entity capable of displaying the attributes associated uniquely with the living state growth metabolism stimulus response and replication in the previous discussions we explicitly narrowed the infinity of chemical complexity potentially available to organic life and we previewed an organizational arrangement moving from simple to complex that provides interesting insights into the functional and structural plan of the cell nevertheless we find no obvious explanation within these features for the living characteristics of cells can we find other themes represented within biomolecules that are explicitly chemical yet anticipate or illuminate the living condition 1.4 properties of biomolecules reflect their fitness to the living condition if we consider what attributes of biomolecules render them so fit as components of growing replicating systems several biologically relevant themes of structure and organization emerge furthermore as we study biochemistry we will see that these themes serve as principles of biochemistry prominent among them is the necessity for information and energy in the maintenance of the living state some biomolecules must have the capacity to contain the information or recipe of life other biomolecules must have the capacity to translate this information so that the blueprint is transformed into the functional organized structures essential to life interactions between these structures are the processes of life an orderly mechanism for abstracting energy from the environment must also exist in order to obtain the energy needed to drive these processes what properties of biomolecules endow them with the potential for such remarkable qualities?

[close]

p. 13

1.4 properties of biomolecules reflect their fitness to the living condition 13 biological macromolecules and their building blocks have a sense or directionality the macromolecules of cells are built of units amino acids in proteins nucleotides in nucleic acids and carbohydrates in polysaccharides that have structural polarity that is these molecules are not symmetrical and so they can be thought of as having a head and a tail polymerization of these units to form macromolecules occurs by head-to-tail linear connections because of this the polymer also has a head and a tail and hence the macromolecule has a sense or direction to its structure figure 1.9 a amino acid h c h+n 3 r1 amino acid h r2 c coo ­ polypeptide h c h n 3 h2o r1 hncohcr2 coo­ coo ­ n sense b ho 4 5 sugar 6 c h n 3 sugar ho 4 5 6 polysaccharide ho ch2oh o ch2oh o ho oh 1 ch2oh o 3 ho 3 ho ho 2 ho 2 oh 1 h2o ho 1 o 4 ch2oh o ho 4 sense 1 oh ho ho oh c nucleotide nh2 n o 5 nucleotide nh2 n o o 5 nucleic acid nh2 n o 5 nnno ho p och2 o 4 3 2 n 1 ho p o­ och2 o 4 3 2 n o ho p o­ och2 o­ 1 h2o 3 2 nh2 nnonnoopo­ och2 5 po4 sense 3 oh oh oh oh oh figure 1.9 a amino acids build proteins by connecting the -carboxyl c atom of one amino acid to the -amino n atom of the next amino acid in line b polysaccharides are built by combining the c-1 of one sugar to the c-4 o of the next sugar in the polymer c nucleic acids are polymers of nucleotides linked by bonds between the 3 -oh of the ribose ring of one nucleotide to the 5 -po4 of its neighboring nucleotide all three of these polymerization processes involve bond formations accompanied by the elimination of water dehydration synthesis reactions 3 oh oh

[close]

p. 14

14 chapter 1 chemistry is the logic of biological phenomena figure 1.10 the sequence of monomeric units in a biological polymer has the potential to contain information if the diversity and order of the units are not overly simple or repetitive nucleic acids and proteins are information-rich molecules polysaccharides are not a strand of dna 5 tacgacggtcagccatagagtcta 3 a polypeptide segment phe ser asn lys gly pro thr glu a polysaccharide chain glc glc glc glc glc glc glc glc glc biological macromolecules are informational because biological macromolecules have a sense to their structure the sequential order of their component building blocks when read along the length of the molecule has the capacity to specify information in the same manner that the letters of the alphabet can form words when arranged in a linear sequence figure 1.10 not all biological macromolecules are rich in information polysaccharides are often composed of the same sugar unit repeated over and over as in cellulose or starch which are homopolymers of many glucose units on the other hand proteins and polynucleotides are typically composed of building blocks arranged in no obvious repetitive way that is their sequences are unique akin to the letters and punctuation that form this descriptive sentence in these unique sequences lies meaning to discern the meaning however requires some mechanism for recognition biomolecules have characteristic three-dimensional architecture the structure of any molecule is a unique and specific aspect of its identity molecular structure reaches its pinnacle in the intricate complexity of biological macromolecules particularly the proteins although proteins are linear sequences of covalently linked amino acids the course of the protein chain can turn fold and coil in the three dimensions of space to establish a specific highly ordered architecture that is an identifying characteristic of the given protein molecule figure 1.11 weak forces maintain biological structure and determine biomolecular interactions figure 1.11 three-dimensional spacefilling representation of part of a protein molecule the antigen-binding domain of immunoglobulin g igg immunoglobulin g is a major type of circulating antibody each of the spheres represents an atom in the structure covalent bonds hold atoms together so that molecules are formed in contrast weak chemical forces or noncovalent bonds hydrogen bonds van der waals forces ionic interactions and hydrophobic interactions are intramolecular or intermolecular attractions between atoms none of these forces which typically range from 4 to 30 kj/mol are strong enough to bind free atoms together table 1.3 the average kinetic energy of molecules at 25°c is 2.5 kj/mol so the energy of weak forces is only several times greater than the dissociating tendency due to thermal motion of molecules thus these weak forces create interactions that are constantly forming and breaking at physiological temperature unless by cumulative number they impart stability to the structures generated by their collective action these weak forces merit further discussion because their attributes profoundly influence the nature of the biological structures they build.

[close]

p. 15

1.4 properties of biomolecules reflect their fitness to the living condition 15 table 1.3 weak chemical forces and their relative strengths and distances force strength kj/mol distance nm description van der waals interactions 0.4­4.0 0.2 hydrogen bonds 12­30 0.3 ionic interactions 20 0.25 hydrophobic interactions 40 strength depends on the relative size of the atoms or molecules and the distance between them the size factor determines the area of contact between two molecules the greater the area the stronger the interaction relative strength is proportional to the polarity of the h bond donor and h bond acceptor more polar atoms form stronger h bonds strength also depends on the relative polarity of the interacting charged species some ionic interactions are also h bonds onh3 ooco force is a complex phenomenon determined by the degree to which the structure of water is disordered as discrete hydrophobic molecules or molecular regions coalesce van der waals attractive forces van der waals forces are the result of induced electrical interactions between closely approaching atoms or molecules as their negatively-charged electron clouds fluctuate instantaneously in time these fluctuations allow attractions to occur between the positively charged nuclei and the electrons of nearby atoms van der waals interactions include dipole­dipole interactions whose interaction energies decrease as 1/r 3 dipole-induced dipole interactions which fall off as 1/r 5 and induced dipole-induced dipole interactions often called dispersion or london dispersion forces which diminish as 1/r 6 dispersion forces contribute to the attractive intermolecular forces between all molecules even those without permanent dipoles and are thus generally more important than dipole­dipole attractions van der waals attractions operate only over a limited interatomic distance and are an effective bonding interaction at physiological temperatures only when a number of atoms in a molecule can interact with several atoms in a neighboring molecule for this to occur the atoms on interacting molecules must pack together neatly that is their molecular surfaces must possess a degree of structural complementarity figure 1.12 at best van der waals interactions are weak and individually contribute 0.4 to 4.0 kj/mol of stabilization energy however the sum of many such interactions within a macromolecule or between macromolecules can be substantial for example model studies of heats of sublimation show that each methylene group in a crystalline hydrocarbon accounts for 8 kj and each coh group in a benzene crystal contributes 7 kj of van der waals energy per mole calculations indicate that the attractive van der waals energy between the enzyme lysozyme and a sugar substrate that it binds is about 60 kj/mol a b phe 91 trp 92 tyr 32 tyr 101 van der waals packing is enhanced in molecules that are structurally complementary gln121 represents a surface protuberance on the protein lysozyme this protuberance fits nicely within a pocket formed by tyr101 tyr32 phe91 and trp92 in the antigen-binding domain of an antibody raised against lysozyme see also figure 1.16 a a space-filling representation b a ball-and-stick model from science 233:751 1986 figure 1.12 gln 121 figure 5

[close]

Comments

no comments yet

YOUBLISHER
About
What Others Say
Sitemap
Impressum

PUBLISHERS
Login
Signup
Tutorials
FAQ
Support

BUSINESS
Overview
Advertising
Support

DEVELOPERS
API

LEGAL
Report a Copyright Violation
Copyright FAQ
Terms of Use
Privacy Policy