Ciencias das Origens 13

 

Embed or link this publication

Description

)Primeiro Semestre 2007

Popular Pages


p. 1

Primeiro Semestre de 2007 Nº 13 Uma publicação do Geoscience Research Institute (Instituto de Pesquisas em Geociências) Estuda a Terra e a vida: sua origem, suas mudanças, sua preservação. Edição em língua portuguesa patrocinada pela DSA da IASD com a colaboração da SCB APRESENTAÇÃO DO DÉCIMO TERCEIRO NÚMERO DE CIÊNCIAS DAS ORIGENS TRADUZIDO PARA A LÍNGUA PORTUGUESA pesquisador que se tem dedicado particularmente ao campo da genética molecular. Como sempre, ficam expressos os agradecimentos da Sociedade Criacionista Brasileira a todos os que colaboraram para possibilitar esta publicação em língua portuguesa, e particularmente, a Roosevelt S. de Castro pelo excelente trabalho de editoração gráfica, e à Profa. Dra. Márcia Oliveira de Paula pela eficiente revisão técnica. Renovam-se também os agradecimentos especiais à Divisão Sul-Americana da Igreja Adventista do Sétimo Dia, na pessoa de seu Presidente, Pastor Erton Koehler, pela continuidade do apoio à publicação deste periódico. A Sociedade Criacionista Brasileira, dentro de sua programação editorial, tem a satisfação de apresentar o décimo terceiro número deste periódico (primeiro número anual de 2007), versão brasileira de “Ciencia de los Orígenes”, editado originalmente pelo “Geoscience Research Institute” (GRI) nos E.U.A. Destacamos o artigo “São os chimpanzés 99,4% idênticos aos seres humanos?” de autoria do Dr. Timothy G. Standisch, do GRI, Ruy Carlos de Camargo Vieira Diretor-Presidente da Sociedade Criacionista Brasileira São os chimpanzés 99,4% idênticos aos seres humanos? Dr. Timothy G. Standish, do Geoscience Research Institute Resumo Existem muitas estatísticas que aparentemente indicam precisão na semelhança entre os genomas do ser humano e do chimpanzé. Embora um exame precipitado dos chimpanzés e dos seres humanos conduza de maneira razoável à expectativa de que os seus DNAs deveriam ter certa semelhança entre si e de que eles seriam mais semelhantes entre si do que poderiam ser ao de outros organismos, freqüentemente essas semelhanças são exageradas e carecem da precisão que usualmente se supõe. Em parte, isso é uma conseqüência das técnicas utilizadas para comparar as seqüências, as quais proporcionam de fato números exatos, mas que não apontam necessariamente para a diferença ou a semelhança entre as seqüências. Outro fator é a maneira pela qual se podem dispor os dados - antes da análise ou como parte do processo da análise. Em última instância, as semelhanças do DNA se assemelham filosoficamente às semelhanças morfológicas e a sua interpretação depende em grande parte da estrutura conceitual filosófica pela qual elas são consideradas. Há pouco tempo os ônibus da minha redondeza apareciam com um aviso novo em cores na sua parte traseira. Em letras de imprensa, proclamava que os seres humanos e os chimpanzés são 98% idênticos1 e acrescentava: “Venha conhecer os seus parentes”. Não estou seguro quanto à eficácia desses anúncios como método de atrair visitantes à nova exposição de símios no Jardim Zoológico, mas para a minha filha, estudante da sétima série, eles a impressionaram. Quando estatísticas como essas que parecem tão precisas chegam a campanhas publicitárias é provável que fiquem gravadas nas mentes tanto de crianças como de adultos. Mas, de onde surgem esses números? E o que eles significam na realidade? MUITOS NÚMEROS, POUCA PRECISÃO Mesmo um exame superficial dos percentuais de semelhança entre o genoma do chimpanzé e do ser humano revela rapidamente que toda a percepção de precisão é ilusória. É comum que apareça o número de 98%2, assim como outros valores diversos. Por exemplo, 99,4% é outro valor publicado que parece ser mais preciso e faz aumentar o parentesco entre os seres humanos e os chimpanzés.3 Quando se comparam partes dos genomas humano e do chimpanzé, um trabalho sugeriu4 que eles são cerca de 98,77% idênticos. Por outro lado, algumas comparações publicadas anteriormente relativas a parte dos genomas humano e dos chimpanzés haviam diminuído essa estimativa para 95%.5 Quando em 2005 foi publicada uma cópia mais ou menos completa do genoma do chimpanzé,6 a conclusão foi de que os genomas do ser humano e do chimpanzé eram 96% semelhantes. Apesar dessa estimativa ser significativamente menor do que a maioria das anteriores, esse novo valor levou a Frans de Waal, especialista em primatas da Emory University, a proclamar: “Darwin não foi somente provocador ao dizer que descendemos dos símios, mas também não foi suficientemente longe... Somos símios em todos os aspectos, desde nossos braços compri-

[close]

p. 2

Figura 1 DIVERSAS MUTAÇÕES DO DNA Micromutações ou Mutações Pontuais: Alterações em um ou alguns poucos nucleotídeos: Substituição - colocação de um nucleotídeo em lugar de outro Estas mutações comumente têm menor impacto. Quando a letra C indicada em itálico Seqüência do DNA: AGTTCAG - TAC - TGA - ACA - CCA - TCA... no primeiro DNA é substituída Seqüência da proteína: pela letra A indicada em itálico no segundo DNA, o códon ACA para Seqüência do DNA: AGTTCAG - TAC - TGA - AAA - CCA - TCA... Cys se transforma no códon AAA para Phe. Seqüência da proteína: Pode haver um grande impacto, destruindo a função de uma proteína ou causando outros problemas. Neste exemplo é retirada a letra Seqüência do DNA: AGTTCAG - TAC - TGA - ACA - CCA - TCA... C indicada em itálico na primeira Seqüência da proteína: seqüência de DNA, alterando o códon Cys para Leu, e alterando Seqüência do DNA: AGTTCAG - TAC - TGA - AAC - CAT - CAA... também o significado dos códons Seqüência da proteína subseqüentes. Deslocamento por perda ou inserção - Perda ou inserção de um ou mais nucleotídeos: Macromutações: Grandes alterações, às vezes visíveis nos cromossomos utilisando um microscópio óptico. Deleção - Perda de seções em um cromossomo Cromossomo original Duplicação - Duplicação de seções de cromossomos Segmento de cromossomo deletado Cromossomo original Inversão - Mudança de orientação de seções de cromossomos Segmento duplicado Cromossomo original Segmento invertido Translocação - Deslocamento de parte do cromossomo para outra parte Cromossomo original dos e corpos sem cauda até nossos hábitos e temperamento”.7 Certamente, Darwin foi sim suficientemente longe sem a ajuda da tecnologia moderna de seqüenciamento de DNA. Não é verdade a cantilena proclamada freqüentemente, de 2 Nº 13 Ciências das Origens Segmento translocado que Darwin jamais afirmou que os seres humanos descendiam dos símios.8 Em seu livro A Origem do Homem, Darwin dedica todo o capítulo 6, intitulado “Sobre as afinidades e a genealogia do homem”, a desenvolver o argumento de que os seres humanos são símios, e portanto, da mesma forma que os demais símios, descenderam de um ancestral comum a todos os símios, ele mesmo um símio.9 Um dos grandes partidários de Darwin, Thomas Henry Huxley, fez com que esse argumento fosse divulgado já em 1863,10 somente quatro

[close]

p. 3

anos após a publicação do livro A Origem das Espécies de Darwin, e muito antes da publicação do A Origem do Homem. “HOMOLOGIA”, DARWINISMO E CRIAÇÃO Dentro dos limites do pensamento darwinista, as semelhanças entre os organismos, que freqüentemente se denominam homologias, são tratadas como evidências de ancestralidade comum. Dessa maneira, pensa-se que dois organismos que possuem mais coisas comuns entre si do que com um terceiro organismo têm um antepassado comum mais recente do que teriam em relação com essa terceira criatura. Por exemplo, tanto as rãs como as vacas possuem olhos do tipo de câmara, quatro patas e muitas outras características comuns, mas as lombrigas não têm estas características, de maneira que, de acordo com o pensamento darwinista, as rãs e as vacas possuem um antepassado comum mais recente do que qualquer dos dois em relação às lombrigas. Ao referir-se ao seqüenciamento de DNA, foi aplicada a mesma lógica: quando se percebe que os chimpanzés e os seres humanos possuem mais DNA em comum do que qualquer um destes em relação a outros organismos, o que é visto como uma forte confirmação das idéias de Darwin. Entretanto, o DNA possui algo mais, já que é o próprio material genético que se transmite de pai para filho. Sob uma perspectiva criacionista, a semelhança do DNA dos seres humanos e dos chimpanzés nada tem de surpreendente. De todos os animais, os chimpanzés e os gorilas são os que mais se parecem com os seres humanos. Seria alarmante descobrir que o Criador teria voltado à sua prancheta de projetos para criar um código completamente diferente para o chimpanzé. Isso seria ilógico, algo como observar que os automóveis Toyota Camry e Corolla são parecidos e então predizer que os projetos de engenharia desses automóveis devem ser completamente diferentes. Os símios se parecem mais com os seres humanos do que as vacas porque, entre outras coisas, o seu DNA é mais semelhante ao dos seres humanos. Isso significa que, se bem que as semelhanças das seqüências de DNA pareçam ser exatamente o que os criacionistas e evolucionistas esperam, alguns darwinistas agem como se isso confirmasse de alguma forma o pensamento darwinista e refutasse de algum modo o Criacionismo. EXPLICANDO AS DIFERENÇAS Uma pergunta ainda mais interessante que a criação explica muito bem e o darwinismo afirma explicar, é de que maneira surgiram essas diferenças entre o genoma dos seres humanos e o do chimpanzé. A explicação disso exige conhecer as diversas espécies de diferenças que poderiam existir entre os dois genomas. A Figura 1 resume algumas dessas diferenças. Apesar das analogias com a linguagem não serem perfeitas, existem suficientes semelhanças entre a maneira com que o DNA codifica a informação e a forma com que as letras codificam a informação na nossa língua portuguesa, de maneira que é possível apresentar – utilizando exemplos de nossa língua – uma ilustração geral dos problemas inerentes e decidir quão semelhantes são duas seqüências de DNA. Lembremos que o DNA é codificado em “letras” moleculares denominadas bases. Diferentemente da língua portuguesa, no “idioma” do DNA existem somente quatro letras, que se abreviam como A, T, G e C. Então, imaginemos duas seqüências de DNA: 1. GAATGC 2. TAATGA Há um total de seis letras em cada uma dessas seqüências e elas só diferem entre si em duas bases, a primeira e a última de cada seqüência. Se somente se comparar o número de letras em comum, então essas seqüências seriam 2/3 ou 67% idênticas. Um exemplo semelhante seria dado em português pelas palavras “tia” e “mia”, que são 67% idênticas se considerarmos as letras, embora seus significados sejam completamente diferentes. No exemplo anterior do DNA, se essas duas seqüências fossem parte de um gene codificador de proteína, teriam significados completamente diferentes. No momento da codificação para a produção de uma proteína, o DNA utiliza palavras denominadas códons, que são compostos por três bases. Cada códon codifica um aminoácido e as proteínas são simplesmente seqüências específicas de aminoácidos que foram agrupadas. Nesse caso particular, as letras GAA da primeira seqüência se referem ao aminoácido ácido glutâmico (glutamato), e as letras TGC 11 referem-se a um aminoácido muito diferente chamado cisteína. Os códons da segunda seqüência TAA e TGA, embora difiram em uma base de cada um dos códons do DNA da primeira seqüência, têm significados totalmente diferentes. De fato, nenhum deles codifica um aminoácido. Esses códons são chamados “códons finalizadores”, já que atuam como pontos no fim de uma frase na linguagem do DNA, isto é, sinalizam onde termina a codificação do DNA em uma proteína. PEQUENAS MUDANÇAS E GRANDES DIFERENÇAS A lição que deve ser lembrada de tudo isso é que mudanças relativamente pequenas no DNA podem fazer uma grande diferença. Esta é a característica comum tanto das seqüências de DNA como das palavras em nossa língua. Às vezes somente deslocar uma letra para uma posição diferente dentro de uma palavra pode fazer uma enorme diferença. No DNA, os códons GGU e UGG codificam aminoácidos, porém o primeiro codifica o aminoácido mais simples, a glicina, enquanto que o segundo codifica o triptofano, que está entre os aminoácidos maiores e mais complexos. SEQÜÊNCIA 1: BETAGLOBINA HUMANA A (HB A) ATGGTGCATC GGAGAAGTCT CCCTGTGGGG GTGGATGAAG GGCCCTGGGC TGGTCTACCC AGGTTCTTTG GGATCTGTCC CTGTTATGGG GTGAAGGCTC AGTGCTCGGT ATGGCCTGGC AACCTCAAGG CACACTGAGT GTGACAAGCT CCTGAGAACT GGGCAACGTG TGCTGGCCCA AAAGAATTCA GCAGGCTGCC TGGTGGCTGG TGACTCCTGA GCCGTTACTG CAAGGTGAAC TTGGTGGTGA AGGCTGCTGG TTGGACCCAG AGTCCTTTGG ACTCCTGATG CAACCCTAAG ATGGCAAGAA GCCTTTAGTG TCACCTGGAC GCACCTTTGC GAGCTGCACT GCACGTGGAT TCAGGCTCCT CTGGTCTGTG TCACTTTGGC CCCCACCAGT TATCAGAAAG TGTGGCTAAT GCCCTGGCCCACAAGTATCACTAA SEQÜÊNCIA 2: BETAGLOBINA HUMANA S (HB S) ATGGTGCATC GGAGAAGTCT CCCTGTGGGG GTGGATGAAG GGCCCTGGGC TGGTCTACCC AGGTTCTTTG GGATCTGTCC CTGTTATGGG GTGAAGGCTC AGTGCTCGGT ATGGCCTGGC AACCTCAAGG CACACTGAGT GTGACAAGCT CCTGAGAACT GGGCAACGTG TGCTGGCCCA AAAGAATTCA GCAGGCTGCC TGGTGGCTGG TGACTCCTGT GCCGTTACTG CAAGGTGAAC TTGGTGGTGA AGGCTGCTGG TTGGACCCAG AGTCCTTTGG ACTCCTGATG CAACCCTAAG ATGGCAAGAA GCCTTTAGTG TCACCTGGAC GCACCTTTGC GAGCTGCACT GCACGTGGAT TCAGGCTCCT CTGGTCTGTG TCACTTTGGC CCCCACCAGT TATCAGAAAG TGTGGCTAAT GCCCTGGCCCACAAGTATCACTAA Nº 13 Ciências das Origens 3

[close]

p. 4

Um exemplo em nossa língua seria simplesmente remover a letra “r” da palavra “rato” e criar uma palavra completamente diferente como “ato”. Na página anterior temos um exemplo de duas seqüências de DNA que diferem em menos de 1%, porém produzem resultados muito diferentes: Existem 444 bases em cada uma dessas seqüências que diferem em somente uma base, a vigésima, na primeira linha da seqüência (ressaltada em negrito).12 Assim, a diferença seqüencial entre estas seqüências é de 0,225%. Elas são 99,775% idênticas, e embora a primeira seqüência codifique uma das proteínas da hemoglobina normal, a segunda seqüência codifica uma proteína anormal, que causa a anemia falciforme, uma enfermidade genética devastadora.13 A diferença de 0,225% na seqüência de DNA se traduz em uma diferença de 0,676% na seqüência da proteína, e essa diferença mínima ocasiona uma séria enfermidade. Nem todas as mudanças desta ordem têm um impasse tão grande, entretanto esta ilustração serve para mostrar que pequenas diferenças nas seqüências de DNA podem produzir (e de fato produzem) diferenças enormes nos organismos. QUANTIFICANDO SEMELHANÇAS E DIFERENÇAS Como se determina se realmente duas seqüências são essencialmente as mesmas ou são totalmente diferentes? Obviamente, olhando simplesmente para as letras individuais, isso não será suficiente para determinar se os dois documentos são diferentes ou semelhantes. As mesmas letras exatas do alfabeto são utilizadas para codificar informação na versão Almeida da Bíblia e no livro A Origem das Espécies. No DNA são utilizadas exatamente as mesmas bases para codificar a informação nos seres humanos e na pequena bactéria Escherichia coli que vive em nosso intestino. Ao comparar livros, pode ser que muitas ou até todas as palavras utilizadas sejam as mesmas, embora os livros sejam claramente diferentes. Ao comparar os organismos, os códons utilizados para codificar as proteínas podem ser os mesmos, mas os organismos são diferentes. Fica claro que um fator importante a ser levado em conta ao comparar as seqüências de DNA é o tamanho das seqüências comparadas. Isso é ilustrado no exercício dado no fim deste capítulo. Outro fator importante a ser considerado ao comparar as seqüências de DNA é que a maneira com que a informação que codifica a forma em que o DNA é expresso como proteína se mostra muito diferente da forma em que expressamos as coisas em nossa língua. Embora seja comum pensar no DNA como codificador principalmente de proteínas, este não é o caso no homem: somente cerca de 3% do DNA humano na realidade 4 Nº 13 Ciências das Origens codifica proteínas. No passado, pensava-se que os 97% restante eram simplesmente desperdícios do processo evolutivo e constituíam essencialmente “DNA lixo”. Com o tempo, tornou-se evidente que uma parte considerável desse DNA não codificado regula a produção de proteínas, enquanto que outras partes participam de atividades vitais adicionais.14 Nos genomas humano e dos chimpanzés, grande parte deste DNA não codificado encontra-se na forma de seqüências repetidas. É difícil calibrar a importância dessas seqüências repetidas ou mesmo avaliá-las, já que apresentam desafios únicos para as técnicas modernas de seqüenciamento de DNA. É por isso que, embora falemos da seqüência do genoma humano como algo completo, ela não está realmente 100% completa. Como se supôs que as seqüências repetidas não tinham importância, estas foram ignoradas em algumas comparações de seqüências. Por exemplo, nos estudos sobre os quais se baseia a percentagem de 98% de semelhança entre o DNA do ser humano e o do chimpanzé, o DNA repetitivo foi eliminado antes de ser feita a comparação.15 Isto é vagamente análogo à comparação das palavras utilizadas em dois livros depois de serem removidas as palavras mais comuns em um idioma,16 algo que claramente poderia desviar o resultado de qualquer comparação estatística. Um fator adicional que complica a observação de comparações entre os genomas de organismos diversos é que as diferenças parecem estar concentradas em áreas específicas de seus genomas, e não distribuídas de maneira aleatória. Por exemplo, os genomas humano e do chimpanzé apresentam essa variação com relação à quantidade de diferenças existentes entre segmentos análogos, o que sugeriu que no passado ambos os organismos tivessem evoluído até se tornarem espécies separadas, e então se separaram durante milhões de anos antes de voltar a se unir há cerca de 6,3 milhões de anos, para então se separarem outra vez.18 Esta variação da quantidade de diferenças evidentes nas seqüências não se encontra somente a nível de DNA, mas também em genes específicos que codificam proteínas específicas. Por exemplo, certo número de genes que sabidamente desempenham um papel no desenvolvimento do sistema nervoso possui – e isso não é surpresa – maiores diferenças do que a média das diferenças entre os genes humanos e os do chimpanzé. Os darwinistas atribuem isso à “seleção positiva” desses genes,19 porém não fica claro como determinar porque essa seleção haveria operado nesses genes relacionados com a inteligência dos antepassados humanos e não nos antepassados do chimpanzé. É difícil imaginar que a inteligência se adapta somente aos seres humanos e seus antepassados. Entretanto, essas variações no grau de diferenças entre os diversos segmentos de DNA não estão restritas a genes individuais ou a parte de cromossomos. Existem diferenças notavelmente pequenas entre os cromossomos X do chimpanzé e os dos seres humanos, em comparação com as diferenças existentes entre os outros cromossomos. Não fica claro de imediato de que maneira a seleção natural poderia ter feito isto, e parece ser necessário algum tipo de distorção para fazer com que os dados se encaixem com as pressuposições darwinistas. COISAS DISTINTAS DERIVADAS DE PARTES SEMELHANTES Existe ainda outra profunda diferença entre a forma com que funcionam o genoma humano e o do chimpanzé, e pode ser que isso seja de maior impacto sobre o fato de que esses genomas não produzem organismos essencialmente idênticos. Compreender isso exige uma forma levemente diferente de ver o papel que desempenham as proteínas nos seres vivos. O DNA codifica as proteínas de maneira muito semelhante à que uma lista de especificações pode definir qual o tipo de parafuso ou peça é utilizado em uma máquina. Podem-se combinar muitas partes de diversas formas para obter tipos diferentes de máquinas. Por exemplo, se se perdesse um parafuso da paleta que mantém unidos um par de tesouras, seria possível substituí-lo por um parafuso de cabeça oca. Ao contrário, poderia ser possível tomar as mesmas partes ou partes muito semelhantes às encontradas numa máquina e combiná-las para produzir um mecanismo muito diferente. Por exemplo, seria possível combinar um feixe de suspensão, alguns parafusos, cabos e algumas outras partes de um veículo para fabricar um excelente arco para atirar flechas. Qual é a relação de tudo isto com o genoma humano e o do chimpanzé? Embora seja tentador pensar que as diferenças entre os seres humanos e os chimpanzés são os resultados entre as diferenças de suas respectivas proteínas, na realidade as diferenças são provavelmente resultado das formas com que as partes das proteínas se agrupam e não das diferenças entre elas. Isso caracteriza exatamente o que se vê quando se produzem proteínas individuais a partir da informação encontrada nos genomas humano e dos chimpanzés, respectivamente. A verdade é que os genes se exprimem de maneira muito diferente nos diversos primatas, aí incluídos os seres humanos e os chimpanzés. Estas diferenças na expressão dos genes parecem ser o resultado das diferenças de um subgrupo de proteínas chamado “fatores de transcrição”.20 Não deveria ser surpreendente descobrir que os darwinistas tam-

[close]

p. 5

bém atribuem essas diferenças à “seleção positiva”. Não é simplesmente que as próprias proteínas se combinam sob diversas formas para formar os diferentes tipos de seres vivos; no que diz respeito aos chimpanzés e aos seres humanos, os próprios genomas se agrupam de maneiras distintas interessantes. Por exemplo, durante a reprodução sexuada, o DNA de ambos os pares é embaralhado da mesma forma que as cartas de um baralho para criar os cromossomos únicos que estarão no espermatozóide e no óvulo e, conseqüentemente, na descendência de um casal. Quando isso acontece, o DNA tem que ser quebrado fisicamente e então colado outra vez. Esse processo é complexo e não se produz ao acaso. Os locais onde se produzem esses cortes e novas combinações (recombinações) são diferentes nos cromossomos dos chimpanzés e nos cromossomos humanos. RESUMO E PRECAUÇÃO Então, os seres humanos são idênticos aos símios? A resposta a que se chega dependerá, em grande parte, das pressuposições filosóficas que sejam incorporadas aos dados. Neste trabalho, tentei mostrar que os valores dados pelos percentuais de diferenças entre os genomas humano e do chimpanzé carecem da precisão que se atribui ao seu uso. Assim mesmo, os lugares dos respectivos genomas que são comparados farão uma diferença muito grande nas conclusões a serem tiradas. Em última análise, a maneira pela qual se traduz a informação do DNA codificado à proteína, e finalmente aos seres vivos, difere profundamente entre os seres humanos e os símios. Se alguém assim desejasse, poderia enfatizar as abundantes diferenças entre o DNA do ser humano e o do chimpanzé. Mesmo assim, é digno de nota que, à medida em que se publica mais informações que comparam os genomas, as diferenças parecem ser mais profundas do que se pensava há uns poucos anos atrás. Porém, seria ridículo sugerir que os chimpanzés não são mais semelhantes aos seres humanos do que as rãs, os peixes, as moscas ou as aves. Em qualquer grupo de objetos ou criaturas, alguns se parecem mais com outros. A grande pergunta é a que conclusão se deveria chegar a partir dessas semelhanças e diferenças. Existe ainda algo mais que deveria servir de alerta a quem deseje chegar a conclusões gerais, e isso é a maneira preocupante pela qual os defensores tanto do darwinismo quanto do criacionismo têm utilizado dados, no passado, em defesa de suas diferentes posturas. Em nossa própria igreja existem numerosas declarações publicadas que, na ocasião, provavelmente não ajudaram e que hoje parecem inquietantes. Por exemplo, Urias Smith sustentava na primeira página da revista denominacional Review and Herald que “Os naturalistas afirmam que a linha divisória entre os seres humanos e os animais foi perdida em confusão. Isso é impossível, já que eles mesmos afirmam saber exatamente onde termina o ser humano e começa o animal”.22 Essa linha de pensamento também pode ser encontrada em declarações posteriores, como a de Dores Robinson, secretária de Ellen G. White, que escreveu: “Qualquer pessoa que observe o chimpanzé, o gorila e o orangotango, não achará difícil crer que eles têm algum antepassado comum com a raça humana. ... É muito mais razoável crer que os símios descenderam do homem...” 23 Por outro lado, pelo menos um darwinista baseado em sua compreensão da semelhança dos 98% entre os genomas humano e do chimpanzé defendeu a aterradora perspectiva de criar quimeras humano-símias, “já que nestes obscuros dias de anti-evolucionismo ignorante, em que existem fundamentalistas religiosos na Casa Branca que controlam o Congresso e tentam distorcer o ensino da ciência em nossas instituições educacionais, uma dose poderosa de realidade biológica seria realmente saudável. E esta é precisamente a mensagem que poderiam transmitir os clones de quimeras, híbridos ou espécies mistas”.24 A Bíblia é explícita com relação ao lugar especial do ser humano na criação. “E criou Deus o homem à sua imagem, à imagem de Deus o criou; macho e fêmea os criou”.25 Devido à sua própria natureza e ao fato de que agora vemos “por espelho, obscuramente”,26 a ciência não pode trazer respostas definitivas sobre a natureza da humanidade; suas conclusões são invariavelmente tentativas e estão sujeitas ao filtro filosófico através do qual os dados são analisados. Embora com essas limitações, é interessante observar que existe a clara tendência, que é evidente em algumas outras áreas da ciência, de que, à medida que aumenta a compreensão e se acumulam os dados, as afirmações temerárias do passado, que pareciam ser inconsistentes com as perspectivas bíblicas tradicionais, são postas em dúvida, enquanto que as perspectivas consistentes com as afirmações bíblicas parecem se tornar mais sustentáveis. 1. Esta estatística se repete em muitos lugares, inclusive no site do Zoológico de San Diego: http://www.sandiegozoo.org/animalbytes/tchimpanzee.html. 2. Por exemplo: Marks, J. 2002. What It Means to Be 98% Chimpanzee: Apes, People, and Their Genes. University of California Press, Berkeley. 325 páginas. 3. Wildam DE, Uddin M, Liu G, Grossman LI, Goodman M. 2003. “Implications of natural selection in shaping 99,4% nonsynonymous REFERÊNCIAS DNA identity between humans and chimpanzee: Enlarging genus Homo.” Proceedings of the National Academy of Sciences (USA) 100:7181-7188. 4. Fujiyama A, Watanabe A, Toyoda A, Taylor TD, Itoh T, Tsai S-F, Park H-S, Yaspo M-L, Lehrach H, Chen Z, Fu G, Saitou N, Osoegawa K, de Jong PJ, Suto Y, Hattori M, Sakakil Y. 2000. “Construction and Analysis of a Human-Chimpanzee Comparative Clone Map.” Science 295:313-134. 5. Britten, R.J. 2002. “Divergence between samples of chimpanzee and human DNA sequences is 5% counting indels.” Proceedings of the National Academy of Sciences (USA) 99:13633-13635. 6. “The Chimpanzee Sequencing and Analysis Consortium. 2005. Initial sequence of the chimpanzee genome and comparison with the human genome.” Nature 437:69-87. 7. É citado Frans de Waal no site Noticias da National Geographic: http://news.nationalgeographic.com/ news/2005/08/0831_050831_chimp_genes. html. 8. Por exemplo, ver: Allen W. 2004. Editorial. National Geographic, Novembro. 9. A seguinte citação do capítulo 6 de A origem do Homem resume a argumentação: “Se for admitido que os símios antropomorfos formam um subgrupo natural, então, como o homem coincide com eles, não só em todas essas características que possui em comum com todo o grupo catarrino [macacos do Velho Mundo], como também em outras características peculiares, tais como a ausência de cauda e calosidades e na aparência geral, se poderia inferir que algum membro antigo do subgupo antropomórfico deu origem ao homem. Não parece provável que, mediante a lei da variação análoga, um membro de uma das outras infra-ordens tenha originado uma criatura semelhante a um homem que se parece com as supra-ordens antropomórficas em tantos aspectos. Sem dúvida que o homem, em comparação com a maioria de seus congêneres, passou por modificações extraordinárias, principalmente como conseqüência do grande desenvolvimento de seu cérebro e sua posição ereta; sem dúvida, deveríamos nos lembrar que este não é senão uma das várias formas excepcionais de primatas.” 10. Huxley TH. 1863. Evidence as to Man’s Place in Nature. 11. Por consistência e para evitar confusão, aqui só nos referimos ao DNA. Observe-se, não obstante, que os códons só se transformam em aminoácidos utilizando cópias de RNA feitas a partir do DNA e no RNA se utiliza a uracila (U) no lugar da timina (T), de maneira que, como cópia de RNA, este códon em realidade seria lido UCG e não TGC. Como RNA, os códons da seqüência 2 seriam lidos UAA e UGA e não TAA e TGA. 12. A proteína madura da betaglobina começa com o aminoácido valina. O aminoácido alterado na betaglobina S é o sexto aminoácido, o ácido glutâmico da betaglobina normal que é convertido em valina na proteína mutada. O primeiro aminoácido codificado nestas seqüências dadas é em realidade a metionina, mas este aminoácido é removido na forma madura da proteína. 13. Esta enfermidade é a anemia falciforme, que ocorre em índices maiores entre os habitantes da África equatorial e seus descendentes. Nº 13 Ciências das Origens 5

[close]

p. 6

Figura 2 Esta fotografia mostra mais de trinta fósseis de estrelas do mar (Equinodermas) conservados em uma placa de rocha arenítica de granulação média. A posição, abundância e características de fossilização das estrelas do mar sugerem em que condições ocorreram a morte e o soterramento. • Os indivíduos estão uniformemente fossilizados, isto é, não apresentam diferentes etapas de decomposição, o que sugere que não se acumularam gradualmente mas sim instantaneamente ou em um curto intervalo de tempo. • Existe superposição de numerosos indivíduos, o que sugere que eles foram acumulados pelo efeito de alguma corrente de água. Um acúmulo gradual poderia ter deixado alguns indivíduos superpostos, mas seria duvidoso que fossem tão abundantes e em espaço tão reduzido. • A conservação das estrelas do mar por si só sugere soterramento rápido em curto intervalo de tempo após a morte. Os indivíduos não apresentam sinais de decomposição por outros organismos do leito marinho e também não existem sinais de decomposição bacteriana, o que seria indicativo de longa exposição no fundo do mar. • O sedimento consiste de areia de granulação média, o que sugere um evento de deposição com elevada energia no fundo do mar. Estas características indicam que as estrelas do mar sofreram algum episódio catastrófico que ocasionou sua morte e rápido soterramento em um curto intervalo de tempo. (Este pedaço de rocha foi comprado na exposição internacional de fósseis de Tucson, Arizona, em 2007 e está exposto atualmente no GRI, Loma Linda, Califórnia, Estados Unidos). 6 Nº 13 Ciências das Origens

[close]

p. 7

Nos indivíduos com anemia falciforme, os glóbulos vermelhos sofrem um alargamento devido à polimerização da hemoglobina ao perder oxigênio. Estas células em forma de foice (falciformes) obstruem os vasos sangüíneos e são destruídas com rapidez, o que resulta em danos aos órgãos e anemia crônica. 14. Standish TG. 2002. “Rushing to judgment: Functionality in noncoding or ‘junk’ DNA”. Origins 53:7-30. 15. Sibley CG, Ahlquist JE (1984) “The phylogeny of the hominoid primates, as indicated by DNADNA hybridization.” Journal of Molecular Evolution 20:2-15. Ver também: Sibley CG, Ahlquist JE. 1987. “DNA hybridization evidence of hominoid phylogeny: Results from an expanded data set.” Journal of Molecular Evolution 26:99-121. Deve-se destacar que o trabalho de Sibley e Ahlquist, apesar de ser citado com freqüência e de ser uma fonte possível dos 98% de semelhança, é controvertido devido a acusações de manipulação dos dados. Ver http://personal. unce.edu/jmarks/DNAHYB/dnahyb2.html. 16. Para apreciar o impacto disso, em inglês, ver http://www.world-english.org/english500. htm ou alguma outra fonte que enumere as palavras mais utilizadas na língua inglesa. 17. Este é o número utilizado no cenário descrito no trabalho que informa estes resultados. A citação é feita para ilustrar o ponto, e não em apoio da idéia que a vida tem milhões de anos. 18. Patterson N, Richter DJ, Gnerre S, Lander ES, Reich D. 2006. “Genetic evidence for complex speciation of humans and chimpanzees.” Nature 441:1103-1108. 19. Ponting C, Jackson AP. 2005. “Evolution of primary microcephaly genes and the enlargement of primate brains.” Current Opinion in Genetics & Development 15:241-248. 20. Gilad Y, Oshlack A, Smyth GK, Speed TP, White KP. 2006. “Expression profiling in primates reveals a rapid evolution of human transcription factors.” Nature 440:242-245. 21. Winckler W, Myers SR, Tichter DJ, Ono frio RC, McDonald GJ, Bontrop RE, McVe an GAT, Gabriel SB, Reich D, Donnelly P, Altshuler D. 2005. “Comparison of FineScale Recombination Rates in Humans and Chimpanzees.” Science 308:107-111. 22. Uriah Smith. “The Visions – Objections Answered: Obj. 37”, Advent Review and Sabbath Herald 28(9) (July 31, 1866): 65, 66. 23. Robinson DE, 1931. “Amalgamation Versus Evolution”. Elmshaven, St. Helena, California, White Document File 316 , Heritage Room, Loma Linda University. 24. David P. Barash DP. 2006. “When Man Mated Monkey”, July 17, 2006, Los Angeles Times . http://www.latimes.com/news/ opinion/la-oe-barash17jul17,0,1775276. story?coll=la-opinion-rightrail. 25. Gênesis 1:27 RV. 26. I Coríntios 13:12. Formulário de Solicitação de Publicações da SCB: Nome:_________________________________________________________________________________________________  Sr.,  Sra.,  Srta. Endereço:________________________________________________________________________________________________________________ CEP: ________________-_______ Cidade: ________________________________ Estado: ___________________ País: _ ____________________ Telefone ou FAX para contatos eventuais: Tel: (____)-_______________ Fax (____)-_______________ e-mail:___________________________________________________________________________________________________________________ Quantidade Código FC-67 FC-68 RC-69 RC-70 RC-71 RC-72 RC-73 RC-74 RC-75 RC-76 RC-77 RC-78 Descrição Folha Criacionista nº 67 Revista Criacionista nº 68 Revista Criacionista nº 69 Revista Criacionista nº 70 Revista Criacionista nº 71 Revista Criacionista nº 72 Revistas Criacionistas nº 73 e 74 Preço unitário 8,00 8,00 10,00 10,00 10,00 10,00 10,00 Preço total (R$) Após receber a comunicação de confirmação de seu pedido, favor efetuar o depósito do valor respectivo, em uma das contas bancárias da Sociedade Criacionista Brasileira, a seguir: Banco Bradesco Agência 241-0 Conta Corrente 204874-4 Banco do Brasil Ag. 1419-2 Conta Corrente 0007643-0 Posteriormente nos encaminhe o comprovante do depósito via fax: (61)3468-3892 ou o recibo escaneado via nosso e-mail: scb@scb.org.br ou cópia xerox via postal para o seguinte endereço: Sociedade Criacionista Brasileira Caixa Postal 08743 70312-970 – Brasília DF BRASIL Ao recebermos o comprovante de depósito, procederemos a remessa do material solicitado. Revistas Criacionistas nº 75 e 76 10,00 Revistas Criacionistas nº 77 e 78 10,00 SUB-TOTAL (Soma de todas as importâncias da solicitação) Caso queira receber o material por SEDEX, o valor do acréscimo será de no mínimo R$ 25,00 ou 20% do total do pedido, o maior dos dois valores. Para entregas normais nenhum valor de postagem será acrescentado. TOTAL (Soma total do pedido a ser depositado na conta corrente conforme descrição ao lado) A OPINIÃO DO LEITOR Na revista Ciências das Origens queremos ouvir a opinião dos leitores. Façam-no chegar seus comentários sobre os artigos publicados, ou sua colaboração para possíveis artigos. Os comentários devem ser pertinentes e breves, com no máximo 150 palavras. Pode-se utilizar a página do GRI na internet: http://www.grisda.org para enviar suas contribuições, que serão avaliadas pela nossa equipe. “CIÊNCIAS DAS ORIGENS” é uma publicação semestral do Geoscience Research Institute, situado no Campus da Universidade de Loma Linda, Califórnia, U.S.A. A Divisão Sul-Americana da Igreja Adventista do Sétimo Dia provê recursos para que esta edição em português de "Ciências das Origens" chegue gratuitamente a professores de cursos superiores interessados no estudo das origens. Interessados no recebimento de números anteriores, em forma impressa, ainda disponíveis, deverão solicitá-los preenchendo o cupom que se encontra na última página deste número. Todas as edições já traduzidas encontram-se disponibilizadas no site www.scb.org.br em formato PDF. Diretor James Gibson Editor Raul Esperante Conselho Editorial Ben Clausen James Gibson Roberto Biaggi Timothy Standish Ronald Nalin Secretária Carol J. Olmo Projeto e diagramação: Katherine Ching Site: http://www.grisda.org e-mail: ciencia@grisda.org Tiragem desta edição: 2.000 exemplares Sociedade Criacionista Brasileira Site: http://www.scb.org.br Nº 13 Ciências das Origens 7

[close]

p. 8

TORNE-SE ASSINANTE E DIVULGADOR DA REVISTA CRIACIONISTA A Revista Criacionista vem sendo publicada pela Sociedade Criacionista Brasileira desde 1972 (inicialmente com a denominação de Folha Criacionista), e hoje é o periódico criacionista mais divulgado em todo o Brasil. A partir do número 73 a Revista, no momento, está disponível só em edição eletrônica (CD-ROM). VÍDEOS DA SÉRIE "DE OLHO NAS ORÍGENS" FC-67 FC-68 RC-69 RC-70 RC-71 RC-72 LANÇAMENTOS RC-73 RC-74 RC-75 RC-76 RC-77 RC-78 UMA MINA PARA O TEMA CRIAÇÃO / EVOLUÇÃO Preencha na página anterior o formulário para solicitação de exemplares da Revista Criacionista. AGRADECEMOS SUA COLABORAÇÃO PARA A DIVULGAÇÃO DA REVISTA CRIACIONISTA Para a aquisição de números de “Ciências das Origens” em português ainda disponíveis em forma impressa, preencher este cupom e enviar para a Sociedade Criacionista Brasileira, no endereço abaixo, com cheque ou depósito bancário em nome da Sociedade Criacionista Brasileira, Banco Bradesco, Agência 241-0 conta corrente 204.874-4 ou Banco do Brasil, Agência 1419-2, conta corrente 7643-0, para o pagamento do porte postal, no valor de R$ 5,00. Nome: _____________________________________________________________________________________________ Endereço para remessa: _______________________________________________________________________________ CEP: _________________ Cidade: ____________________________________________ Unidade da Federação: ______ e-mail: _____________________________________________ Telefone: (____) __________________________________ Enviar por e-mail, fax ou correio normal, juntamente com cópia do comprovante de depósito ou cheque para: Sociedade Criacionista Brasileira Caixa Postal 08743 70312-970 – Brasília DF BRASIL Telefax: (61) 3468-3892 ou (61) 3468-1984 e-mail: scb@scb.org.br Site: http://www.scb.org.br 8 Nº 13 Ciências das Origens

[close]

Comments

no comments yet